<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1746-4811-4-18</ui>
   <ji>1746-4811</ji>
   <fm>
      <dochead>Methodology</dochead>
      <bibl>
         <title>
            <p>A community resource for high-throughput quantitative RT-PCR analysis of transcription factor gene expression in <it>Medicago truncatula</it></p>
         </title>
         <aug>
            <au id="A1">
               <snm>Kakar</snm>
               <fnm>Klementina</fnm>
               <insr iid="I1"/>
               <email>kakar@mpimp-golm.mpg.de</email>
            </au>
            <au id="A2">
               <snm>Wandrey</snm>
               <fnm>Maren</fnm>
               <insr iid="I1"/>
               <email>wandrey@gfz-potsdam.de</email>
            </au>
            <au id="A3">
               <snm>Czechowski</snm>
               <fnm>Tomasz</fnm>
               <insr iid="I1"/>
               <email>tc519@york.ac.uk</email>
            </au>
            <au id="A4">
               <snm>Gaertner</snm>
               <fnm>Tanja</fnm>
               <insr iid="I1"/>
               <email>gaertner@mpimp-golm.mpg.de</email>
            </au>
            <au id="A5">
               <snm>Scheible</snm>
               <fnm>Wolf-R&#252;diger</fnm>
               <insr iid="I1"/>
               <email>scheible@mpimp-golm.mpg.de</email>
            </au>
            <au id="A6">
               <snm>Stitt</snm>
               <fnm>Mark</fnm>
               <insr iid="I1"/>
               <email>stitt@mpimp-golm.mpg.de</email>
            </au>
            <au id="A7">
               <snm>Torres-Jerez</snm>
               <fnm>Ivone</fnm>
               <insr iid="I3"/>
               <email>itjerez@noble.org</email>
            </au>
            <au id="A8">
               <snm>Xiao</snm>
               <fnm>Yongli</fnm>
               <insr iid="I2"/>
               <email>yxiao@jcvi.org</email>
            </au>
            <au id="A9">
               <snm>Redman</snm>
               <mi>C</mi>
               <fnm>Julia</fnm>
               <insr iid="I2"/>
               <email>jredman@jcvi.org</email>
            </au>
            <au id="A10">
               <snm>Wu</snm>
               <mi>C</mi>
               <fnm>Hank</fnm>
               <insr iid="I2"/>
               <email>hwu@jcvi.org</email>
            </au>
            <au id="A11">
               <snm>Cheung</snm>
               <fnm>Foo</fnm>
               <insr iid="I2"/>
               <email>FCheung@jcvi.org</email>
            </au>
            <au id="A12">
               <snm>Town</snm>
               <mi>D</mi>
               <fnm>Christopher</fnm>
               <insr iid="I2"/>
               <email>cdtown@jcvi.org</email>
            </au>
            <au id="A13" ca="yes">
               <snm>Udvardi</snm>
               <mi>K</mi>
               <fnm>Michael</fnm>
               <insr iid="I1"/>
               <insr iid="I3"/>
               <email>mudvardi@noble.org</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Max-Planck Institute of Molecular Plant Physiology, Am M&#252;hlenberg 1, 14476 Potsdam-Golm, Germany</p>
            </ins>
            <ins id="I2">
               <p>The J. Craig Venter Institute, 9704 Medical Center Drive, Rockville, MD, 20850, USA</p>
            </ins>
            <ins id="I3">
               <p>The Samuel Roberts Noble Foundation, 2510 Sam Noble Parkway, Ardmore, OK, 73401, USA</p>
            </ins>
         </insg>
         <source>Plant Methods</source>
         <issn>1746-4811</issn>
         <pubdate>2008</pubdate>
         <volume>4</volume>
         <issue>1</issue>
         <fpage>18</fpage>
         <url>http://www.plantmethods.com/content/4/1/18</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">18611268</pubid>
               <pubid idtype="doi">10.1186/1746-4811-4-18</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>15</day>
               <month>4</month>
               <year>2008</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>08</day>
               <month>7</month>
               <year>2008</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>08</day>
               <month>7</month>
               <year>2008</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2008</year>
         <collab>Kakar et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p><it>Medicago truncatula </it>is a model legume species that is currently the focus of an international genome sequencing effort. Although several different oligonucleotide and cDNA arrays have been produced for genome-wide transcript analysis of this species, intrinsic limitations in the sensitivity of hybridization-based technologies mean that transcripts of genes expressed at low-levels cannot be measured accurately with these tools. Amongst such genes are many encoding transcription factors (TFs), which are arguably the most important class of regulatory proteins. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) is the most sensitive method currently available for transcript quantification, and one that can be scaled up to analyze transcripts of thousands of genes in parallel. Thus, qRT-PCR is an ideal method to tackle the problem of TF transcript quantification in Medicago and other plants.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>We established a bioinformatics pipeline to identify putative TF genes in <it>Medicago truncatula </it>and to design gene-specific oligonucleotide primers for qRT-PCR analysis of TF transcripts. We validated the efficacy and gene-specificity of over 1000 TF primer pairs and utilized these to identify sets of organ-enhanced TF genes that may play important roles in organ development or differentiation in this species. This community resource will be developed further as more genome sequence becomes available, with the ultimate goal of producing validated, gene-specific primers for all Medicago TF genes.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>High-throughput qRT-PCR using a 384-well plate format enables rapid, flexible, and sensitive quantification of all predicted Medicago transcription factor mRNAs. This resource has been utilized recently by several groups in Europe, Australia, and the USA, and we expect that it will become the 'gold-standard' for TF transcript profiling in <it>Medicago truncatula</it>.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="bmc" subtype="user_supplied_xml" id="endnote"/>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Legumes are second only to grasses in agricultural importance <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. They are a mainstay of sustainable agricultural systems because of their ability to reduce atmospheric nitrogen (N<sub>2</sub>) to ammonia via a symbiosis with bacteria called rhizobia. This provides legumes and subsequent crops with a free and renewable source of nitrogen in lieu of expensive, environmentally-unfriendly fertilizers. Development and differentiation of root nodules, the organ that accommodates nitrogen-fixing rhizobia in legumes, is orchestrated by transcription factors <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr></abbrgrp>. Transcription factors are DNA-binding proteins that regulate the transcription of most, if not all genes <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. As a result, TFs play central roles in all aspects of plant biology, including development and differentiation of organs and adaptive responses to changes in the environment <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. Transcription factors as a whole are an important target of plant research because they are a key to understanding the regulation of important plant processes as well as potential tools to optimize these processes for agriculture.</p>
         <p>The importance of TFs in plant biology is reflected by the fact that approximately 5% of all plant genes encode such proteins <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. Thus, even species with relatively small genomes, such as <it>Arabidopsis thaliana </it>contain thousands of TF genes <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. This presents a real challenge for systematic approaches to decipher the function of TF genes in plants. Classical, 'forward' genetics has uncovered the roles of perhaps a hundred TF genes in Arabidopsis <abbrgrp><abbr bid="B12">12</abbr></abbrgrp> and far fewer in other species <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. Reverse-genetic approaches, using T-DNA insertion mutants for instance <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>, provide a means to decipher in a systematic and relatively rapid manner the function of TF genes/proteins, although gene-redundancy often stymies this enterprise <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>. Another stumbling-block is that phenotypes associated with non-redundant TFs may be subtle in nature.</p>
         <p>Transcript profiling can help to uncover the functions of TF genes/proteins by revealing where and when in a plant TF genes are expressed. This information can help direct our attention to particular organs, developmental stages, or conditions under which aberrant phenotypes might become apparent in a TF mutant of interest.</p>
         <p><it>Medicago truncatula </it>is a model legume species that is currently the focus of an international genome sequencing effort <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. Several generations of cDNA <abbrgrp><abbr bid="B15">15</abbr></abbrgrp> and oligonucleotide arrays <abbrgrp><abbr bid="B16">16</abbr></abbrgrp> have been developed for transcriptome analysis of <it>Medicago truncatula</it>, including most-recently an Affymetrix GeneChip that contains 51,000 probe-sets representing a large proportion of all the genes in this species <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>. While these tools now provide a means to measure the transcriptional output of a large proportion of genes in Medicago, inherent limitations in the sensitivity of hybridization-based technologies <abbrgrp><abbr bid="B18">18</abbr></abbrgrp> mean that transcripts of a substantial number of genes cannot be detected even when probes for these transcripts are present on the array/chip. Furthermore, expansion of arrays to encompass novel genes uncovered by genome sequencing is not a trivial task. An alternative to arrays that is 2&#8211;3 orders of magnitude more sensitive and more flexible in terms of expansion to encompass novel genes is quantitative reverse transcription-polymerase chain reaction (qRT-PCR). Platforms for qRT-PCR analysis of thousands of Arabidopsis and rice TF genes have been developed by us and others <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr></abbrgrp>, and utilized to identify TF genes involved in Arabidopsis responses to nutrient stress and pathogen attack <abbrgrp><abbr bid="B21">21</abbr><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr><abbr bid="B24">24</abbr></abbrgrp>. Here we describe a bioinformatics pipeline to identify putative TF genes in <it>Medicago truncatula </it>and to design gene-specific oligonucleotide primers for qRT-PCR analysis of all predicted TF transcripts. Over 1000 TF primer pairs were tested and used to identify sets of organ-enhanced TF genes that may play important roles in organ development or differentiation in this species.</p>
      </sec>
      <sec>
         <st>
            <p>Results and Discussion</p>
         </st>
         <sec>
            <st>
               <p>Identification of putative transcription factors</p>
            </st>
            <p>TF protein families are generally defined by the type(s) of DNA-binding domain they contain and putative TF genes are often identified on the basis of DNA sequences that encode known DNA-binding domains <abbrgrp><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr><abbr bid="B25">25</abbr><abbr bid="B26">26</abbr></abbrgrp>. We utilized this approach to identify putative TFs of Medicago amongst the set of proteins predicted from genomic sequence by the International Medicago Genome Annotation Group (IMGAG). Proteins of IMGAG release 1, which contained over 40,000 predicted proteins, were screened for the presence of known or presumed DNA-binding domains (Table <tblr tid="T1">1</tblr>), using INTERPRO <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>. Medicago proteins containing putative DNA binding domains and other domains associated with TFs were then used as query sequences in WU-BLASTX <abbrgrp><abbr bid="B28">28</abbr></abbrgrp> which included searches of both the non-redundant DNA database of NCBI <abbrgrp><abbr bid="B29">29</abbr></abbrgrp> and the well-curated protein database, UniProt <abbrgrp><abbr bid="B30">30</abbr></abbrgrp> to check annotations of related proteins in support of tentative Medicago TF assignments. This process resulted in a list of 1045 putative TF genes (see Additional file <supplr sid="S1">1</supplr>). We utilized genomic sequences rather than the large collection of partial cDNA sequences present in Expressed Sequence Tag (EST) databases for Medicago as the starting point for TF gene discovery because protein sequences derived from genomic sequence are more complete and the set of IMGAG proteins essentially contains no redundancy. Although identification of the 'complete' set of Medicago TFs from IMGAG-annotated proteins will only be possible upon completion of genome sequencing, we expect little or no redundancy in the protein set targeted by our primer set. This approach avoids wasting money on redundant primer sets and re-organization of primers when redundancy is detected, both of which would have been inevitable if we chose to use ESTs in addition to genomic sequences to identify Medicago TFs.</p>
            <suppl id="S1">
               <title>
                  <p>Additional file 1</p>
               </title>
               <text>
                  <p>Complete list of TF genes, primer sequences and corresponding PCR efficiencies. The TF primer platform was established based on the data for the gene models according to SA, specific amplification; NA, no amplification; NS, non-specific amplification. RT-PCR products of primer sequences indicated in bold were sequenced.</p>
               </text>
               <file name="1746-4811-4-18-S1.xls">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Classification of putative transcription factors of Medicago into families and sub-families</p>
               </caption>
               <tblbdy cols="5">
                  <r>
                     <c ca="center">
                        <p>
                           <b>TF Family</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>No. of </b>
                        </p>
                        <p>
                           <b>Genes</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Characteristic Domain </b>
                        </p>
                        <p>
                           <b>(InterPro No.)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Domain</b>
                        </p>
                        <p>
                           <b>Function</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Domain Description</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>MYB/HD-like</p>
                     </c>
                     <c ca="center">
                        <p>76</p>
                     </c>
                     <c ca="center">
                        <p>IPR001005, IPR009057</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>Myb, DNA-binding; homeodomain like</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>MYB</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                     <c ca="center">
                        <p>IPR001005</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>Myb, DNA-binding</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>C<sub>2</sub>H<sub>2 </sub>(Zn)</p>
                     </c>
                     <c ca="center">
                        <p>64</p>
                     </c>
                     <c ca="center">
                        <p>IPR007087</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                     <c ca="center">
                        <p>Zn-finger, C2H2 type</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>AP2/EREBP</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>55</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>IPR001471</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>D</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Pathogenesis-related transcriptional factor and ethylene response factor</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>BHLH</p>
                     </c>
                     <c ca="center">
                        <p>49</p>
                     </c>
                     <c ca="center">
                        <p>IPR001092</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>Basic helix-loop-helix dimerisation region bHLH</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>HD-like</p>
                     </c>
                     <c ca="center">
                        <p>50</p>
                     </c>
                     <c ca="center">
                        <p>IPR009057</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>Homeodomain like</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>HD family</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>IPR001356</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>Homeobox</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>HD</p>
                     </c>
                     <c ca="center">
                        <p>25</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>HD-ZIP</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>IPR006712</p>
                     </c>
                     <c ca="center">
                        <p>P</p>
                     </c>
                     <c ca="center">
                        <p>HD-ZIP protein, N terminus</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>HD-PHD finger</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>IPR001965</p>
                     </c>
                     <c ca="center">
                        <p>P</p>
                     </c>
                     <c ca="center">
                        <p>Zn-finger like, PHD-finger</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>MADS</p>
                     </c>
                     <c ca="center">
                        <p>48</p>
                     </c>
                     <c ca="center">
                        <p>IPR002100</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>TF, MADS-box</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>BZIP</p>
                     </c>
                     <c ca="center">
                        <p>41</p>
                     </c>
                     <c ca="center">
                        <p>IPR004827</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>Basic Leu zipper (bZIP) TF</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>PHD</p>
                     </c>
                     <c ca="center">
                        <p>34</p>
                     </c>
                     <c ca="center">
                        <p>IPR001965</p>
                     </c>
                     <c ca="center">
                        <p>P</p>
                     </c>
                     <c ca="center">
                        <p>Zn-finger like, PHD-finger</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>WRKY family</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>
                           <b>IPR003657</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>D</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>DNA-binding WRKY</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>
                           <b>WRKY</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>29</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>
                           <b>LLR WRKY</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>1</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>IPR001611</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Leu-rich repeat</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>ABI3/VP1</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>29</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>IPR003340</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>D</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>TF B3</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>NAC</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>29</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>IPR003441</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>D</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>No apical meristem (NAM) protein</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>C<sub>3</sub>H-type1(Zn)</p>
                     </c>
                     <c ca="center">
                        <p>27</p>
                     </c>
                     <c ca="center">
                        <p>IPR000571</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>Zn-finger, C-x8-C-x5-C-x3-H type</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>ARF</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>23</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>IPR003340, IPR010525, IPR011525</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>D</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>JUMONJI</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                     <c ca="center">
                        <p>IPR003347</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>TF jumonji, jmjC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>GRAS</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>19</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>IPR005202</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>P</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>GRAS TF</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>HMG</p>
                     </c>
                     <c ca="center">
                        <p>15</p>
                     </c>
                     <c ca="center">
                        <p>IPR000637</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>HMG-I and HMG-Y, DNA binding</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>AS2</p>
                     </c>
                     <c ca="center">
                        <p>14</p>
                     </c>
                     <c ca="center">
                        <p>IPR004883</p>
                     </c>
                     <c ca="center">
                        <p>P</p>
                     </c>
                     <c ca="center">
                        <p>Lateral organ boundaries</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>C<sub>2</sub>C<sub>2 </sub>(Zn)</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>
                           <b>Dof</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>13</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>IPR003851</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>D</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Zn-finger, Dof type</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>GATA</p>
                     </c>
                     <c ca="center">
                        <p>7</p>
                     </c>
                     <c ca="center">
                        <p>IPR000679</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>Zn-finger, GATA type</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>
                           <b>CO-like</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>6</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>IPR000315</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>D</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Zn-finger, B-box</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>
                           <b>YABBY</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>5</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>IPR006780</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>D</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>YABBY protein</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CCAAT-HAP3 type</p>
                     </c>
                     <c ca="center">
                        <p>12</p>
                     </c>
                     <c ca="center">
                        <p>IPR003958</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>TF CBF/NF-Y/archaeal histone</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>GRF</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>8</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>IPR010666</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>D</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Zn-finger, GRF type</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>SBP</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>8</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>IPR004333</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>D</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>SBP</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>EIL</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>7</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>IPR006957</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>D</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Ethylene insensitive 3</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>LIM</p>
                     </c>
                     <c ca="center">
                        <p>7</p>
                     </c>
                     <c ca="center">
                        <p>IPR001781</p>
                     </c>
                     <c ca="center">
                        <p>P</p>
                     </c>
                     <c ca="center">
                        <p>Zn-binding protein, LIM</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>SNF2</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="center">
                        <p>IPR000330</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>SNF2 family N-terminal domain</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>E2F/DP</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>IPR003316</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>TF E2F/dimerisation partner (TDP)</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>TCP</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>5</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>IPR005333</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>D</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>TCP TF</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>FHA</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>5</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>IPR000253</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>D</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Forkhead-associated</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ARID</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>IPR001606</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>AT-rich interaction region</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>HSF</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>IPR000232</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>Heat shock factor (HSF)-type, DNA binding</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>AUX/IAA</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>3</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>IPR003311</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>D</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>AUX/IAA protein</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>SRS</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>3</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>IPR006510</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>D</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Zn-finger, LRP1 type</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TUB</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>IPR000007</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>Tubby</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ZIM</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>IPR010399</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>ZIM</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DDT</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>IPR004022</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>DDT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>ZF-HD</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>2</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>IPR006455</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>D</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Homeobox domain, ZF-HD class</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>MBF1</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>2</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>IPR001387</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>D</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Helix-turn-helix type 3</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>S1Fa-like</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>2</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>IPR006779</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>D</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>DNA binding protein S1FA</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>CAMTA</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>2</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>IPR005559</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>D</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>CG-1</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>LFY</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>1</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>IPR002910</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>D</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Floricaula/leafy protein</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Nin-like</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>1</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>IPR003035</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>D</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Plant regulator RWP-RK</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>TAZ</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>1</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>IPR000197</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>P</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Zn-finger, TAZ-type</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="5" ca="left">
                        <p>
                           <b>Potentially novel plant TFs and transcriptional regulators</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="5">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CCHC (Zn)</p>
                     </c>
                     <c ca="center">
                        <p>112</p>
                     </c>
                     <c ca="center">
                        <p>IPR001878</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                     <c ca="center">
                        <p>Zn-finger, CCHC-type</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>RR</p>
                     </c>
                     <c ca="center">
                        <p>16</p>
                     </c>
                     <c ca="center">
                        <p>IPR001789, IPR011006</p>
                     </c>
                     <c ca="center">
                        <p>RD</p>
                     </c>
                     <c ca="center">
                        <p>Response regulator receiver</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>DHHC (Zn)</p>
                     </c>
                     <c ca="center">
                        <p>14</p>
                     </c>
                     <c ca="center">
                        <p>IPR001594</p>
                     </c>
                     <c ca="center">
                        <p>D or P</p>
                     </c>
                     <c ca="center">
                        <p>Zn-finger, DHHC-type</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>HTH</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>FIS</p>
                     </c>
                     <c ca="center">
                        <p>11</p>
                     </c>
                     <c ca="center">
                        <p>IPR002197</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>Helix-turn-helix, Fis-type</p>
                     </c>
                  </r>
                  <r>
                     <c ca="right">
                        <p>AraC</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>IPR000005</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>Helix-turn-helix, AraC type</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>BTB/POZ</p>
                     </c>
                     <c ca="center">
                        <p>7</p>
                     </c>
                     <c ca="center">
                        <p>IPR000210</p>
                     </c>
                     <c ca="center">
                        <p>P</p>
                     </c>
                     <c ca="center">
                        <p>BTB</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TTF-type (Zn)</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="center">
                        <p>IPR006580</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>Zn-finger, TTF-type</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>BD</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="center">
                        <p>IPR001487</p>
                     </c>
                     <c ca="center">
                        <p>P</p>
                     </c>
                     <c ca="center">
                        <p>Bromodomain</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Lambda-DB</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>IPR010982</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>Lambda_DNA_bd</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TrpR</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>IPR010921</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>Trp repressor/replication initiator</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TPR</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>IPR001440</p>
                     </c>
                     <c ca="center">
                        <p>P</p>
                     </c>
                     <c ca="center">
                        <p>Tetratricopeptide TPR_1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>KRAB-box</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>IPR001909</p>
                     </c>
                     <c ca="center">
                        <p>P</p>
                     </c>
                     <c ca="center">
                        <p>KRAB box</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>NRs</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>IPR008946</p>
                     </c>
                     <c ca="center">
                        <p>LBD</p>
                     </c>
                     <c ca="center">
                        <p>Steroid nuclear receptor, ligand binding</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>R3H</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>IPR001374</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                     <c ca="center">
                        <p>Single-stranded nucleic acid binding R3H</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>YEATS</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>IPR005033</p>
                     </c>
                     <c ca="center">
                        <p>TA</p>
                     </c>
                     <c ca="center">
                        <p>YEATS</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>U1-type (Zn)</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>IPR003604</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                     <c ca="center">
                        <p>Zn-finger, U1-type</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>A20-like</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                     <c ca="center">
                        <p>IPR002653</p>
                     </c>
                     <c ca="center">
                        <p>P</p>
                     </c>
                     <c ca="center">
                        <p>Zn-finger, A20-type</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Euk_TF</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>IPR008917</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>Euk_TF, DNA binding</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>NGN</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>IPR006645</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>NGN</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>p53-like</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>IPR008967</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>p53-like TF, DNA binding</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>SSB protein</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>IPR011344</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>Single-strand binding protein</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>ssDB TR</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>IPR009044</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>Single-strand DNA binding transcriptional regulator</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TCoAp15</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>IPR003173</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>Transcriptional coactivator p15</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>BED-type (Zn)</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>IPR003656</p>
                     </c>
                     <c ca="center">
                        <p>D</p>
                     </c>
                     <c ca="center">
                        <p>Zn-finger, BED-type predicted</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TCoA</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>IPR009255</p>
                     </c>
                     <c ca="center">
                        <p>TA</p>
                     </c>
                     <c ca="center">
                        <p>Transcriptional coactivation</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Tc/PD</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>IPR001533</p>
                     </c>
                     <c ca="center">
                        <p>TA</p>
                     </c>
                     <c ca="center">
                        <p>Transcriptional coactivator</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>IMGAG (International Medicago Gene Annotation Group)-proteins were classified as putative TFs if they contained characteristic DNA-binding or other characteristic TF domains and if annotations of matching proteins obtained by BLAST searches were consistent with such a classification. TF families previously identified in plants are presented in the first part of the table while potentially novel plant TF families, which were identified by the presence of domains associated with TFs and other transcriptional regulators outside the plant kingdom, are presented in the latter part of the table. D = DNA binding domain; P = protein-protein interaction domain; NA = nucleic acid (DNA and RNA) binding domain; RD = receiver domain; LBD = ligand binding; transcriptional co-activator. Plant-specific TF families and sub-families are indicated in bold (according to <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>)</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>PCR primer design</p>
            </st>
            <p>To ensure maximum specificity and efficiency during PCR amplification of TF cDNA under a standard set of reaction conditions, a stringent set of criteria was used for primer design. This included predicted melting temperatures (<it>T</it><sub>m</sub>) of 58&#176;C to 61&#176;C, limited self-complementarity and poly-X, and PCR amplicon lengths of 100&#8211;150 base pairs (bp). Secondary hits were minimized by aligning primer candidates to all known Medicago sequences via WU-BLAST <abbrgrp><abbr bid="B28">28</abbr></abbrgrp> and eliminating primer pairs with multiple potential hits.</p>
         </sec>
         <sec>
            <st>
               <p>PCR primer testing: gene-specificity and amplification efficiency</p>
            </st>
            <p>PCR primers were tested on Medicago cDNA free of genomic DNA contamination as follows. First, total RNA was extracted from various organs using Trizol reagent (Invitrogen GmbH, Karlsruhe, Germany), which yielded high quality RNA as judged by gel electrophoresis and by Agilent 2100 BioAnalyser using RNA 6000 Nano Chips (Agilient Technologies, Waldbronn, Germany). Typical RNA yields ranged from 0.5&#8211;1.0 &#956;g RNA/mg fresh mass for nodules and leaves, respectively. Isolated RNA was treated with DNAse I (Ambion, product number 1907) to remove all contaminating genomic DNA, and this was always confirmed by PCR using primers to non-coding regions of the <it>Ubiquitin </it>gene (TC102473; AC137828-19.4). After inactivation of DNAse I, RNA was reverse transcribed using SuperScript III reverse transcriptase (Invitrogen GmbH, Karlsruhe, Germany) and oligo-dT<sub>12&#8211;18 </sub>to prime the reaction.</p>
            <p>Specificity of PCR primers was assessed in three ways: by melting curve analysis of PCR reaction products; by separating the products of all reactions via electrophoresis in 3% agarose gels; and by sequencing a sub-set of PCR reaction products (Figure <figr fid="F1">1</figr>). 94.5% (998/1045) of primer pairs gave unique PCR products of the expected size. Only 3.3% (34/1045) of primer pairs yielded no product and 2.2% (23/1045) gave non-specific products. (see Additional file <supplr sid="S1">1</supplr>). Sequencing was performed on 178 randomly-chosen PCR products amplified from a 1:1 mixture of leaf and root cDNA. In the vast majority of cases (92.7% or 165/178), the sequence of the PCR product was identical to that of the intended target gene. In 5.1% of cases, the amplicon sequence matched multiple related genes, including the target gene, while in only 2.2% of cases the amplicon sequence did not match the target gene sequence.</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Specificity of transcription factor PCR primers</p>
               </caption>
               <text>
                  <p><b>Specificity of transcription factor PCR primers</b>. Specificity was confirmed by dissociation curves with a single peak (A) while double peaks (B) indicated off-target ampification. The derivative of fluorescence intensity is shown on the y-axis. Separation of PCR products on 3% (v/w) agarose gels following electrophoresis (C) confirmed the presence of unique amplicons of the expected size for most reactions. Few reactions yielded no products (indicated by arrow).</p>
               </text>
               <graphic file="1746-4811-4-18-1"/>
            </fig>
            <p>Ideally, PCR results in an exact doubling of the amount of dsDNA after each temperature cycle. In practice, however, this is generally not the case because the reactions are less than 100% efficient. Primer sequences can affect PCR efficiency, so we determined the efficiency of each TF primer pair from amplification plots, using LinRegPCR software <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>. First, the correlation coefficient derived from linear regression analysis of each amplification plot (e.g. see Figure <figr fid="F2">2</figr>) was used to assess the 'quality' of each reaction, and all reactions with an R<sup>2 </sup>&lt; 0.990 were excluded from further analysis (10.6% of reactions). Next, average PCR efficiencies (E) were computed for each individual primer pair across all analyzed samples. 53.4% (558 TF genes) displayed PCR efficiencies greater than 0.80, while 39.7% (415 TF genes) had efficiencies between 0.51&#8211;0.80. Only 2.6% (27 TF genes) had mean E values below 0.4; these all yielded R<sup>2 </sup>&lt; 0.99 in LinRegPCR analysis and mostly represented reactions that lacked detectable fragment amplification (C<sub>T </sub>> 40) or that generated unspecific PCR products (Figure <figr fid="F2">2</figr>; see Additional file <supplr sid="S1">1</supplr>). A similar range of PCR efficiencies were determined for Arabidopsis and rice TF primers previously <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr></abbrgrp>.</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Amplification efficiency of transcription factor-specific primer pairs</p>
               </caption>
               <text>
                  <p><b>Amplification efficiency of transcription factor-specific primer pairs</b>. Typical real-time RT-PCR amplification plots of 384 TF genes (left) and distribution of PCR efficiencies for all 1045 TF primer pairs (right).</p>
               </text>
               <graphic file="1746-4811-4-18-2"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Selection of reference genes</p>
            </st>
            <p>Reference genes with stable expression/transcript levels throughout development and in the face of environmental challenge are crucial for the normalization of expression data of other genes. Potentially useful reference genes were chosen based on published data for Medicago (e.g. <it>Msc27 </it><abbrgrp><abbr bid="B32">32</abbr></abbrgrp>) and <it>Arabidopsis thaliana </it><abbrgrp><abbr bid="B33">33</abbr></abbrgrp>. The closest Medicago homologues of Arabidopsis genes were identified by BlastN <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>. Gene-specific primer pairs for the genes encoding elongation factor 1&#945; (EST317575), glyceralaldehyde-3-phosphate dehydrogenase (MtC00030_GC; CT573421_3.4), &#946;-tubulin (TC106341), Pentatricopeptide repeat protein (TC96273), actin2 (TC107326; AC137836_27.5), Ubiquitin (TC102473; AC137828-19.4), Helicase (CB892427), and the genes <it>PDF2 </it>(TC107161), <it>UPL7 </it>(TC111218), <it>PTB </it>(TC111751), <it>UBC </it>(AW686873), <it>bHLH </it>(CX538576), and <it>UBC9 </it>(TC106312) were designed using the criteria described above (Table <tblr tid="T2">2</tblr>). The specificity of PCR primers was tested using 18 first-strand cDNAs from six different organs of <it>Medicago </it>(three biological replicates each). All primer pairs produced a single PCR product of the expected size, as shown by gel electrophoresis and unique dissociation curves generated by the PCR machine after 40 cycles (Figure <figr fid="F3">3</figr>). To determine which reference genes were best suited for transcript normalisation, we used the software geNORM <abbrgrp><abbr bid="B34">34</abbr></abbrgrp>, which uses pair-wise comparison and geometric averaging across a matrix of biological samples to determine gene expression stability (M; <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>). The genes <it>PDF2</it>, <it>PPRep</it>, <it>Ubiquitin, and PTB h</it>ad the lowest M (greatest transcript stability) and, therefore, were judged to be the best reference genes for this diverse set of developmental samples (Figure <figr fid="F4">4</figr>; Table <tblr tid="T2">2</tblr>).</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Medicago reference genes and primers for qRT-PCR</p>
               </caption>
               <tblbdy cols="7">
                  <r>
                     <c ca="center">
                        <p>
                           <b>Gene Name</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>TC</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Accession</b>
                        </p>
                        <p>
                           <b>Number</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Forward/Reverse Primer (5'-3')</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>PCR </b>
                        </p>
                        <p>
                           <b>Product</b>
                        </p>
                        <p>
                           <b> Size (bp)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>PCR </b>
                        </p>
                        <p>
                           <b>efficiency</b>
                        </p>
                        <p>
                           <b> (E)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>R</b>
                           <sup>2</sup>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>&#946; Tubulin</p>
                     </c>
                     <c ca="center">
                        <p>TC106341</p>
                     </c>
                     <c ca="center">
                        <p>N</p>
                     </c>
                     <c ca="center">
                        <p>TTTGCTCCTCTTACATCCCGTG / GCAGCACACATCATGTTTTTGG</p>
                     </c>
                     <c ca="center">
                        <p>100</p>
                     </c>
                     <c ca="center">
                        <p>1.08</p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>PPRrep</p>
                     </c>
                     <c ca="center">
                        <p>TC96273</p>
                     </c>
                     <c ca="center">
                        <p>N</p>
                     </c>
                     <c ca="center">
                        <p>GGAAAACTGGAGGATGCACGTA / ACAAGCCCTCGACACAAAACC</p>
                     </c>
                     <c ca="center">
                        <p>100</p>
                     </c>
                     <c ca="center">
                        <p>0.93</p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>PDF 2</p>
                     </c>
                     <c ca="center">
                        <p>TC107161</p>
                     </c>
                     <c ca="center">
                        <p>N</p>
                     </c>
                     <c ca="center">
                        <p>GTGTTTTGCTTCCGCCGTT / CCAAATCTTGCTCCCTCATCTG</p>
                     </c>
                     <c ca="center">
                        <p>100</p>
                     </c>
                     <c ca="center">
                        <p>0.99</p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>bHLH</p>
                     </c>
                     <c ca="center">
                        <p>CX538576</p>
                     </c>
                     <c ca="center">
                        <p>N</p>
                     </c>
                     <c ca="center">
                        <p>TAGCGAGTACCATGATGCCAGA / GCGCCTCTTTTGTTTTCAGC</p>
                     </c>
                     <c ca="center">
                        <p>100</p>
                     </c>
                     <c ca="center">
                        <p>0.89</p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>UBC</p>
                     </c>
                     <c ca="center">
                        <p>AW686873</p>
                     </c>
                     <c ca="center">
                        <p>N</p>
                     </c>
                     <c ca="center">
                        <p>CTGACAGCCCACTGAATTGTGA / TTTTGGCATTGCTGCAAGC</p>
                     </c>
                     <c ca="center">
                        <p>100</p>
                     </c>
                     <c ca="center">
                        <p>0.96</p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>PTB</p>
                     </c>
                     <c ca="center">
                        <p>TC111751</p>
                     </c>
                     <c ca="center">
                        <p>N</p>
                     </c>
                     <c ca="center">
                        <p>CGCCTTGTCAGCATTGATGTC / TGAACCAGTGCCTGGAATCCT</p>
                     </c>
                     <c ca="center">
                        <p>100</p>
                     </c>
                     <c ca="center">
                        <p>0.85</p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>Ubiquitin</p>
                     </c>
                     <c ca="center">
                        <p>TC102473</p>
                     </c>
                     <c ca="center">
                        <p>AC137828_19.4</p>
                     </c>
                     <c ca="center">
                        <p>GCAGATAGACACGCTGGGA / AACTCTTGGGCAGGCAATAA</p>
                     </c>
                     <c ca="center">
                        <p>100</p>
                     </c>
                     <c ca="center">
                        <p>0.95</p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>UBC9</p>
                     </c>
                     <c ca="center">
                        <p>TC106312</p>
                     </c>
                     <c ca="center">
                        <p>AC137602_2.4</p>
                     </c>
                     <c ca="center">
                        <p>GGTTGATTGCTCTTCTCTCCCC / AAGTGATTGCTCGTCCAACCC</p>
                     </c>
                     <c ca="center">
                        <p>100</p>
                     </c>
                     <c ca="center">
                        <p>1.13</p>
                     </c>
                     <c ca="center">
                        <p>0.99</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>Helicase</p>
                     </c>
                     <c ca="center">
                        <p>CB892427</p>
                     </c>
                     <c ca="center">
                        <p>N</p>
                     </c>
                     <c ca="center">
                        <p>GTACGAGGTCGGTGCTCTTGAA / GCAACCGAAAATTGCACCATAC</p>
                     </c>
                     <c ca="center">
                        <p>100</p>
                     </c>
                     <c ca="center">
                        <p>0.91</p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>ELF1&#945;</p>
                     </c>
                     <c ca="center">
                        <p>EST317575</p>
                     </c>
                     <c ca="center">
                        <p>N</p>
                     </c>
                     <c ca="center">
                        <p>GACAAGCGTGTGATCGAGAGATT / TTTCACGCTCAGCCTTAAGCT</p>
                     </c>
                     <c ca="center">
                        <p>100</p>
                     </c>
                     <c ca="center">
                        <p>0.68</p>
                     </c>
                     <c ca="center">
                        <p>0.98</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>UPL7</p>
                     </c>
                     <c ca="center">
                        <p>TC111218</p>
                     </c>
                     <c ca="center">
                        <p>N</p>
                     </c>
                     <c ca="center">
                        <p>CCAGTTGTTCTCGTGGTCCATT / CCTCCAATTGTCGCCCAAA</p>
                     </c>
                     <c ca="center">
                        <p>100</p>
                     </c>
                     <c ca="center">
                        <p>0.93</p>
                     </c>
                     <c ca="center">
                        <p>1.00</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>GAPDH</p>
                     </c>
                     <c ca="center">
                        <p>MtC00030_GC</p>
                     </c>
                     <c ca="center">
                        <p>CT573421_3.4</p>
                     </c>
                     <c ca="center">
                        <p>TGCCTACCGTCGATGTTTCAGT / TTGCCCTCTGATTCCTCCTTG</p>
                     </c>
                     <c ca="center">
                        <p>100</p>
                     </c>
                     <c ca="center">
                        <p>1.04</p>
                     </c>
                     <c ca="center">
                        <p>0.99</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>Actin2</p>
                     </c>
                     <c ca="center">
                        <p>TC107326</p>
                     </c>
                     <c ca="center">
                        <p>AC137836_27.5</p>
                     </c>
                     <c ca="center">
                        <p>TCAATGTGCCTGCCATGTATGT / ACTCACACCGTCACCAGAATCC</p>
                     </c>
                     <c ca="center">
                        <p>100</p>
                     </c>
                     <c ca="center">
                        <p>1.12</p>
                     </c>
                     <c ca="center">
                        <p>0.99</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>MSC27</p>
                     </c>
                     <c ca="center">
                        <p>X63872 (<it>M. sativa</it>)</p>
                     </c>
                     <c ca="center">
                        <p>N</p>
                     </c>
                     <c ca="center">
                        <p>GTTGAAGTAGACATTGGTGCTAACG / AGCTGAGTCATCAACACCCTCAT</p>
                     </c>
                     <c ca="center">
                        <p>100</p>
                     </c>
                     <c ca="center">
                        <p>0.76</p>
                     </c>
                     <c ca="center">
                        <p>0.99</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Mean PCR efficiency (E) was determined from three biological replicates of each of six organs, using LinRegPCR <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>, which also yielded mean R<sup>2</sup>. N, no corresponding GenBank accession number.</p>
               </tblfn>
            </tbl>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Specificity, efficiency, and reproducibility of PCR primers designed to amplify reference gene transcripts</p>
               </caption>
               <text>
                  <p><b>Specificity, efficiency, and reproducibility of PCR primers designed to amplify reference gene transcripts</b>. Specificity of primers was confirmed by the presence of unique amplicons of the expected size following electrophoresis on 3% (v/w) agarose gels (A) and by dissociation curves with a single peak (B to D). Typical real-time RT-PCR amplification plots of three reference gene transcripts (E to G).</p>
               </text>
               <graphic file="1746-4811-4-18-3"/>
            </fig>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Ranking of 8 reference genes in <it>M. truncatula</it></p>
               </caption>
               <text>
                  <p><b>Ranking of 8 reference genes in <it>M. truncatula</it></b>. Transcript levels of all 8 genes were measured by qRT-PCR, using 18 independent cDNA preparations from six different organs with three replicate measurements of each cDNA preparation. A low value for the average expression stability M, as calculated by geNORM software, indicates more stable expression throughout the various organs.</p>
               </text>
               <graphic file="1746-4811-4-18-4"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Identification of organ-enhanced TFs of Medicago</p>
            </st>
            <p>To get an overview of TF gene expression in <it>Medicago truncatula </it>and to identify TFs induced in specific organs, we used the real-time RT-PCR platform described above. Transcript profiling was performed on six different organs of <it>Medicago </it>(leaves, stems, flowers, pods, roots, and nodules) with three independent biological replicates for each (see Additional file <supplr sid="S2">2</supplr>). The fraction of genes for which transcripts were detected within 40 cycles ranged from 77.2% in leaves to 90.8% in pods. Transcripts from nearly all putative TF genes (96.8% or 1011/1045) were detected in at least one organ. Genes were called detected if they were expressed in at least two biological replicates with a C<sub>T </sub>&lt; 40. Approximately half of all TF genes exhibited differential expression during plant development, based on significant differences (p &#8804; 0.05) in transcript levels between organs. Few TF genes (1.19% or 12/1011) were expressed exclusively in vegetative organs (leaves, stems, roots or nodules), and even fewer (0.5% or 5/1011) were expressed only in reproductive organs (flowers or pods). A relatively small number of TF genes exhibited greater than ten-fold ratios in expression level in one organ compared to any other organ (Table <tblr tid="T3">3</tblr>). For comparison, we have included gene expression ratios derived from Affymetrix array data from the same RNA samples. While there is reasonable qualitative agreement between gene expression ratios obtained using the two methods, the lack of quantitative agreement is likely due to the limited sensitivity and low signal to noise ratio near the detection limit of Affymetrix arrays <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>. The genes listed in Table <tblr tid="T3">3</tblr> may control development and/or differentiation in Medicago and are interesting targets for future research.</p>
            <suppl id="S2">
               <title>
                  <p>Additional file 2</p>
               </title>
               <text>
                  <p>Complete list of TF genes, gene families and experimental data. Shown are the Medicago gene Accession Numbers (TIGR) in ascending order, the TC number if available, as well as the transcription factor family and the subfamily names. The next columns show experimental results for the real-time RT-PCR reactions performed on six different organs of Medicago in three indipendent biological replicates, as explained in the manuscript. CT = not normalized CT value, &#916;CT = CT value normalized against the geometric mean of 4 house keeping genes; &#916;&#916;CT = power(PCReff;-&#916;CT); log2 &#916;&#916;CT = logarithmus of &#916;CT.</p>
               </text>
               <file name="1746-4811-4-18-S2.xls">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Organ-enhanced TF genes</p>
               </caption>
               <tblbdy cols="12">
                  <r>
                     <c cspan="12" ca="left">
                        <p><b>A </b>Root-enhanced TF genes identified by real-time RT-PCR</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="12">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="5" ca="center">
                        <p>
                           <b>Real-time RT-PCR Expression Ratio</b>
                        </p>
                     </c>
                     <c cspan="5" ca="center">
                        <p>
                           <b>Affymetrix Expression Ratio</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="12">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>Accession Number</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>R/L</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>R/S</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>R/F</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>R/P</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>R/N</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>R/L</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>R/S</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>R/F</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>R/P</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>R/N</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Affymetrix Chip ID</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="12">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>AC140721_12.1</p>
                     </c>
                     <c ca="center">
                        <p>121.5</p>
                     </c>
                     <c ca="center">
                        <p>320.1</p>
                     </c>
                     <c ca="center">
                        <p>1623.4</p>
                     </c>
                     <c ca="center">
                        <p>2676.5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>64.4</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>161.2<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>144.5<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>219.2<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>158.1<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>99.9</p>
                     </c>
                     <c ca="center">
                        <p>Mtr.50075.1.S1_s_at</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>AC135101_25.1</p>
                     </c>
                     <c ca="center">
                        <p>312.2</p>
                     </c>
                     <c ca="center">
                        <p>438.0</p>
                     </c>
                     <c ca="center">
                        <p>291.6</p>
                     </c>
                     <c ca="center">
                        <p>787.0</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>61.3</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>n</p>
                     </c>
                     <c ca="center">
                        <p>n</p>
                     </c>
                     <c ca="center">
                        <p>n</p>
                     </c>
                     <c ca="center">
                        <p>n</p>
                     </c>
                     <c ca="center">
                        <p>n</p>
                     </c>
                     <c ca="center">
                        <p>n</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>AC140721_14.1</p>
                     </c>
                     <c ca="center">
                        <p>1204.9</p>
                     </c>
                     <c ca="center">
                        <p>751.2</p>
                     </c>
                     <c ca="center">
                        <p>956.6</p>
                     </c>
                     <c ca="center">
                        <p>6296.6</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>32.6</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>n</p>
                     </c>
                     <c ca="center">
                        <p>n</p>
                     </c>
                     <c ca="center">
                        <p>n</p>
                     </c>
                     <c ca="center">
                        <p>n</p>
                     </c>
                     <c ca="center">
                        <p>n</p>
                     </c>
                     <c ca="center">
                        <p>n</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>AC140031_3.1</p>
                     </c>
                     <c ca="center">
                        <p>275.4</p>
                     </c>
                     <c ca="center">
                        <p>1157.3</p>
                     </c>
                     <c ca="center">
                        <p>923.4</p>
                     </c>
                     <c ca="center">
                        <p>258916.9<sup>a</sup></p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>31.1</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.4</p>
                     </c>
                     <c ca="center">
                        <p>0.7</p>
                     </c>
                     <c ca="center">
                        <p>0.8</p>
                     </c>
                     <c ca="center">
                        <p>0.9</p>
                     </c>
                     <c ca="center">
                        <p>2.2</p>
                     </c>
                     <c ca="center">
                        <p>Mtr.47227.1.S1_s_at</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>AC140721_13.1</p>
                     </c>
                     <c ca="center">
                        <p>39.9<sup>a</sup></p>
                     </c>
                     <c ca="center">
                        <p>179.8</p>
                     </c>
                     <c ca="center">
                        <p>614.8</p>
                     </c>
                     <c ca="center">
                        <p>935.1<sup>a</sup></p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>26.5</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>35.9</p>
                     </c>
                     <c ca="center">
                        <p>48.1<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>41.2</p>
                     </c>
                     <c ca="center">
                        <p>44.2<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>39.5</p>
                     </c>
                     <c ca="center">
                        <p>Mtr.50074.1.S1_at</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>AC140031_7.1</p>
                     </c>
                     <c ca="center">
                        <p>360.2<sup>a</sup></p>
                     </c>
                     <c ca="center">
                        <p>830.6</p>
                     </c>
                     <c ca="center">
                        <p>1542<sup>a</sup></p>
                     </c>
                     <c ca="center">
                        <p>6868.8</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>19.7</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.7<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>1<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>1.1<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>1<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>0.9<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>Mtr.47229.1.S1_at</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>AC146574_6.1</p>
                     </c>
                     <c ca="center">
                        <p>1095.7</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>11.9</b>
                           <sup>a</sup>
                        </p>
                     </c>
                     <c ca="center">
                        <p>48.8</p>
                     </c>
                     <c ca="center">
                        <p>51.8</p>
                     </c>
                     <c ca="center">
                        <p>88.8</p>
                     </c>
                     <c ca="center">
                        <p>1.2<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>1.1<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>1.3<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>1.1<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>1.2<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>Mtr.40781.1.S1_s_at</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>AC125478_13.7</p>
                     </c>
                     <c ca="center">
                        <p>1117.4</p>
                     </c>
                     <c ca="center">
                        <p>7008.0</p>
                     </c>
                     <c ca="center">
                        <p>3264.9<sup>a</sup></p>
                     </c>
                     <c ca="center">
                        <p>7256.6</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>11.6</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>211.5<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>248.8<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>296.4<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>228.7<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>45.3</p>
                     </c>
                     <c ca="center">
                        <p>Mtr.15416.1.S1_at</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>AC125478_7.2</p>
                     </c>
                     <c ca="center">
                        <p>1052.3</p>
                     </c>
                     <c ca="center">
                        <p>503.3</p>
                     </c>
                     <c ca="center">
                        <p>938.4<sup>a</sup></p>
                     </c>
                     <c ca="center">
                        <p>2754.5</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>11.2</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>n</p>
                     </c>
                     <c ca="center">
                        <p>n</p>
                     </c>
                     <c ca="center">
                        <p>n</p>
                     </c>
                     <c ca="center">
                        <p>n</p>
                     </c>
                     <c ca="center">
                        <p>n</p>
                     </c>
                     <c ca="center">
                        <p>n</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>AC122726_21.111</p>
                     </c>
                     <c ca="center">
                        <p>50.0</p>
                     </c>
                     <c ca="center">
                        <p>48.0</p>
                     </c>
                     <c ca="center">
                        <p>20943.9</p>
                     </c>
                     <c ca="center">
                        <p>2658.6</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>10.4</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>74.3<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>76.4<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>72.8<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>82.8<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>26.6</p>
                     </c>
                     <c ca="center">
                        <p>Mtr.15568.1.S1_s_at</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="12">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="12" ca="left">
                        <p><b>B </b>Nodule-enhanced TF genes identified by real-time RT-PCR</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="12">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="5" ca="center">
                        <p>
                           <b>Real-time RT-PCR Expression Ratio</b>
                        </p>
                     </c>
                     <c cspan="5" ca="center">
                        <p>
                           <b>Affymetrix Expression Ratio</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="12">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>Accession Number</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>N/L</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>N/S</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>N/F</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>N/P</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>N/R</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>N/L</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>N/S</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>N/F</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>N/P</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>N/R</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Affymetrix Chip ID</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="12">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>AC148816_3.2</p>
                     </c>
                     <c ca="center">
                        <p>9966.7</p>
                     </c>
                     <c ca="center">
                        <p>1826.2</p>
                     </c>
                     <c ca="center">
                        <p>6262.9</p>
                     </c>
                     <c ca="center">
                        <p>21709.1</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>662.7</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>434.6<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>516.8<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>455<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>521.7<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>551.4<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>Mtr.14503.1.S1_at</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>AC147774_3.2</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>55.2</b>
                           <sup>a</sup>
                        </p>
                     </c>
                     <c ca="center">
                        <p>466.7</p>
                     </c>
                     <c ca="center">
                        <p>726.3</p>
                     </c>
                     <c ca="center">
                        <p>881.2</p>
                     </c>
                     <c ca="center">
                        <p>498.5</p>
                     </c>
                     <c ca="center">
                        <p>17.7<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>16<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>17.8<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>19.1<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>16.1<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>Mtr.19554.1.S1_at</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>AC138056_33.241</p>
                     </c>
                     <c ca="center">
                        <p>43.9</p>
                     </c>
                     <c ca="center">
                        <p>93.2</p>
                     </c>
                     <c ca="center">
                        <p>18.3</p>
                     </c>
                     <c ca="center">
                        <p>17.3</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>13.1</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.9<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>0.8<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>0.8<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>1.1<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>1.1<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>Mtr.17993.1.S1_at</p>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>AC124214_39.2</p>
                     </c>
                     <c ca="center">
                        <p>121.8</p>
                     </c>
                     <c ca="center">
                        <p>92.1</p>
                     </c>
                     <c ca="center">
                        <p>44.8</p>
                     </c>
                     <c ca="center">
                        <p>64.9</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>10.5</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>n</p>
                     </c>
                     <c ca="center">
                        <p>n</p>
                     </c>
                     <c ca="center">
                        <p>n</p>
                     </c>
                     <c ca="center">
                        <p>n</p>
                     </c>
                     <c ca="center">
                        <p>n</p>
                     </c>
                     <c ca="center">
                        <p>n</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="12">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="12" ca="left">
                        <p><b>C </b>Pod-enhanced TF genes identified by real-time RT-PCR</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="12">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="5" ca="center">
                        <p>
                           <b>Real-time RT-PCR Expression Ratio</b>
                        </p>
                     </c>
                     <c cspan="5" ca="center">
                        <p>
                           <b>Affymetrix Expression Ratio</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="12">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>
                           <b>Accession Number</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>P/L</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>P/S</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>P/F</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>P/N</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>P/R</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>P/L</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>P/S</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>P/F</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>P/N</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>P/R</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Affymetrix Chip ID</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="12">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="center">
                        <p>AC143340_4.7</p>
                     </c>
                     <c ca="center">
                        <p>154.1</p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>44.8</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>173.3</p>
                     </c>
                     <c ca="center">
                        <p>180.3<sup>a</sup></p>
                     </c>
                     <c ca="center">
                        <p>407.3</p>
                     </c>
                     <c ca="center">
                        <p>1.6<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>1.8<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>1.7<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>1.7<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>1.7<sup>b</sup></p>
                     </c>
                     <c ca="center">
                        <p>Mtr.17931.1.S1_at</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="12">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="12" ca="left">
                        <p><b>D </b>Flower-enhanced TF genes identified by real-time RT-PCR</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="12">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="5" ca="center">
                        <p>
                           <b>Real-time RT-PCR Expression Ratio</b>
                        </p>
                     </c>
                     <c cspan="5" ca="center">
                        <p>
                           <b>Affymetrix Expression Ratio</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c cspan="12">
                        <hr/>
                     </c>
                  </r>
                  <r>
                